User talk:Steven Crossin/Archive 5

Latest comment: 16 years ago by Nanobri in topic Mediator
Archive 1 Archive 3 Archive 4 Archive 5 Archive 6 Archive 7 Archive 10

What's this?

  The Special Barnstar
For suffering through vandalism on your userpages and continued determination in fighting vandalism. ÐeadΣyeДrrow (Talk | Contribs) 07:07, 12 March 2008 (UTC)
  • Oh, sweet  . Thanks a lot. Well, like I said, me being vandalised will not stop my efforts. Nothing will. Unless an admin tells me to stop reverting vandalism. But, I doubt that would ever happen. Steve Crossin (talk) 07:11, 12 March 2008 (UTC)
Yeah, you've been a vandal magnet lately. I've tried to keep your page watched. The quality of our enemies is still kind of lacking, though, but they do seem to make up for brainpower in terms of sheer numbers. Good luck! Redrocket (talk) 07:16, 12 March 2008 (UTC)
Steve, you have a long way to go if you want to be considered amongst the elite in terms of vandalism to your pages. :D Enigma msg! 07:19, 12 March 2008 (UTC)
  • Thanks alot for looking out for me. I really appreciate it, alot. You would think that as I use Huggle, I would be able to revert vandalism on my own pages, but it seems that someone beats me to it. And, agreed. Some vandals are very sneaky, like changing facts, figures, and dates, but there was one recently that was quite funny. See the edits above, where they said the population was like 1 squillion. I found that amusing. But, most of the vandalism is very obvious, such as replacing/inserting "penis" on pages. Well, small things entertain small minds. And, I'm looking out for all of you as well, anyone who has reverted vandalism on my pages I add to my watchlist, so I can return the favour. Enigmaman, i don't doubt I have a long way to go. I know it. But, I seem to be doing OK. That's not why I do it, though. I do it because I just think vandalism is disruptive, and I'll do all to stop it. Thanks again. Steve Crossin (talk) 07:23, 12 March 2008 (UTC)
  • Exactly. Anyway, I think anyone using Huggle becomes a big target, simply because of the capability you have with Huggle. You can revert a lot of vandalism in short amounts of time, and some of the vandals you reverted are bound to be angry about it. I often don't get to revert vandalism to my own pages, also. Enigma msg! 07:28, 12 March 2008 (UTC)
  • Oh, that's definetly true. I've been slightly hindered by the new version of Huggle, it's kinda buggy, keeps freezing on me. But, it's definetly improved from the last version. Now all we need is more warning templates built into it. Vandalism, Spam, Test edit feels insufficient, more should be included. Steve Crossin (talk) 07:39, 12 March 2008 (UTC)
I feel you can call yourself amongst the elite once you've been attacked by a goatse vandal. Late at night when there are no admins around to give you page protection. Example: Don't worry it's just a history link Those were a lot harder to revert back in the day before rollback. --ÐeadΣyeДrrow (Talk | Contribs) 07:59, 12 March 2008 (UTC)
  • Agreed, I've had the situation where I had to constantly rollback a user's page, it was being vandalised constantly, [1] and the report to AIV was taking a while to block the IP. Happened eventually, shows me that some people really are determined. Steve Crossin (talk) 08:06, 12 March 2008 (UTC)
  • Yeah, I had an especially bad case once, where it was taking a while for my AIV report to be acted on. Check out March 5. Enigma msg! 08:13, 12 March 2008 (UTC)

Sovereign Grace Ministries

Hey Steve. I happened to notice your name on MBisanz's page, asking about admin coaching, while at the same time I've been commenting occasionally at Talk:Sovereign Grace Ministries. If you're hoping to get admin-related experience, the issues over at SGM would certainly be good practice for you! Though I've only skimmed the controversy there, it has the earmarks of the intractable problems that admins are often asked to deal with. Extra points if you can get those folks to agree on anything! It could wind up being escalated if no-one is willing to be reasonable. EdJohnston (talk) 12:35, 12 March 2008 (UTC)

  • I've tried some informal mediation, to get the contributors to discuss proposed changes to the article, and to discuss objections as to why/why not they should be included, as it's really a content dispute. But, I agree, this sort of thing would be good practice. I'll do my best :) Steve Crossin (talk) 12:38, 12 March 2008 (UTC)

Level 1

Yep, I just downgraded it from Level 1 only a few minutes ago. If you think so, upgrade it again. :) Rudget. 14:44, 12 March 2008 (UTC)

Thanks. Rudget. 14:50, 12 March 2008 (UTC)


Princess Theresa of Leiningen

I hope you are not basing your assumptions on just one single website. Please see the following links:

[2] [3][4] [5][6][7][8]. She is 112th in line of succession to the British throne[9]

Can you please amend your assumption quick and prompto! —Preceding unsigned comment added by 213.165.224.166 (talk) 15:11, 12 March 2008 (UTC)

  • I don't know where the article I edited/reverted is, but feel free to undo my edit if I made a mistake. I may make a few mistakes, the current level of vandalism is "Severe", in my haste, I may have done something by accident. Please undo my edit, and accept my apologies. Steve Crossin (talk) 15:15, 12 March 2008 (UTC)
    • I cannot undo since you have set the auto bot revert. I have tried several times and the article contain wrong information. —Preceding unsigned comment added by 213.165.224.166 (talk) 15:16, 12 March 2008 (UTC)


  • If a bot is reverting your edit, then the bot believes your edit to be vandalism. If you believe that your edit is not vandalism, and the bot is malfunctioning, you can contact an administrator. Steve Crossin (talk) 15:23, 12 March 2008 (UTC)

List of television series canceled after one episode

Please do not threaten an edit war, as you did with your hidden comment on List of television series canceled after one episode. If you are an admin, you already know that such a threat is doubly discouraged under Wikipedia guidelines and policies. If there is repeated removal of Viva Laughlin despite its been canceled on Australia's Nine network, I'd suggest punching up the writing to emphasize it and de-emphasize its three-episode run on CBS. B.Wind (talk) 00:06, 13 March 2008 (UTC)

  • Thank you for the response and understanding. It seems that you were not aware of the hidden comment when you reverted a previous edit that removed a large section of text (and, to be sure, I would have missed it, too, if I were reverting quickly). A more detailed reply is on my talk page, but I found the original entry with the threat (by Kevin586) posted about two months ago. Good luck on the RfA when you decide to go for it. B.Wind (talk) 00:48, 13 March 2008 (UTC)

Non-constructive??

What do you mean, precisely? I was making a request for the article to appear on the main page. How is that non-constructive? :-/ mike40033 (talk) 03:46, 13 March 2008 (UTC)

  • Hmm, I don't recall making that edit. But if I did, it would have been an accident. My apologies. Steve Crossin (talk) 04:53, 13 March 2008 (UTC)

De nada

No problems, glad to help. You've truly captivated the attention of some nimrods, haven't you? Redrocket (talk) 05:46, 13 March 2008 (UTC)

  • Oh, I sure have. You would think that vandals have something better to do, but apparently not. Well, I know someone is looking out for me :) Thanks. Steve Crossin (talk) 05:47, 13 March 2008 (UTC)

Award

 
Slakr's Acetone Award

For excellent effort in reverting vandalism, you are hereby awarded some acetone to help scrub out the toughest of attempts at turning articles to mush. Plus, if you ever need to get nail polish off, it'll help with that too. :P

Thanks for helping out. =) - ALLSTAR echo 07:02, 13 March 2008 (UTC)

NPWatcher application

Your NPWatcher application has been approved. Good luck with the extra tool. Rudget. 12:56, 13 March 2008 (UTC)

Welcome to VandalProof!

Thank you for your interest in VandalProof, Steve Crossin! You have now been added to the list of authorized users, so if you haven't already, simply download and install VandalProof from our main page. If you have any questions, please feel free to contact me or any other moderator, or you can post a message on the discussion page. Ale_Jrbtalk 18:23, 15 March 2008 (UTC)

I award you this barnstar for your efforts!

  The RickK Anti-Vandalism Barnstar
I see you so many nights, tirelessly fighting vandals. If anyone deserves this, it's you. Casull 07:20, 17 March 2008 (UTC)
  • Thanks alot :D You're too kind. I actually thought the new message was another vandal vandalising my page, but it wasn't, so I was pleasantly suprised. Thanks again :D Steve Crossin (talk) 07:23, 17 March 2008 (UTC)
  Sorry 'bout that. delldot talk 07:54, 17 March 2008 (UTC)

Reverted vandalism??

Hi, you reverted my edits at page "UltraStar" and said they were vandalism. But i just deleted wrong information cause UltraStar does not violate any gpl laws due to bass is a free-to-use lib for non commercial projects the source must not be provided.84.60.164.154 (talk) 12:38, 17 March 2008 (UTC)

  • Well, I saw your edit was reverted previously by another patroller, and generally an unexplained removal of content is generally considered to possibly be vandalism. However, if it wasn't vandalism, I would suggest you try to write more clear edit summaries, so we know the edit is not vandalism. Have a nice day :) Steve Crossin (talk) 12:44, 17 March 2008 (UTC)

You are right that it was reverted by another partoller but that was due i deleted without using the edit summary. The second time i used it but then it got reverted by you :). I´ll try again. Greets 84.60.164.154 (talk) 12:46, 17 March 2008 (UTC)

Award

  The RickK Anti-Vandalism Barnstar
Outstanding job of countering vandalism!! - P|^|C (talk) 12:53, 17 March 2008 (UTC)
  • Thanks alot :D I don't fight vandalism for barnstars, but they are nice to get :P Steve Crossin (talk) 12:54, 17 March 2008 (UTC)
    • You deserve it! - P|^|C (talk) 12:57, 17 March 2008 (UTC)

I leave you a message

What the heck is your problem.

Congratulations, Mr Revert Warrior. Good work, I guess! -84.234.60.154 (talk) 17:27, 17 March 2008 (UTC)

Oh, I forget,

  The RickK Anti-Vandalism Barnstar
Outstanding job of countering my edits!! --84.234.60.154 (talk) 17:31, 17 March 2008 (UTC)

Because you people seem to love this sillyness. --84.234.60.154 (talk) 17:31, 17 March 2008 (UTC)

  • Well, Okay then. Rather amusing, but, a barnstar is a barnstar, I suppose :D Steve Crossin (talk) 17:34, 17 March 2008 (UTC)

Wikisin

I've committed a WikiSin. I wrote a message to a friend on myspace and I added ~~~~ at the end of it. They were like wtf? --ÐeadΣyeДrrow (Talk | Contribs) 19:36, 17 March 2008 (UTC)

  • Oh, I do that all the time in emails. It's kind of sad actually, some of my emails are like made of wikimarkup. It shows how obsessed you are ;) Steve Crossin (talk) 20:00, 17 March 2008 (UTC)

I even tried to link with wiki brackets a few times, though I caught those. It's just so much more convenient than HTML. --ÐeadΣyeДrrow (Talk | Contribs) 20:05, 17 March 2008 (UTC)

Slime volleyball AfC

It is an online game. I don't think it's notable enough for inclusion but it definitely exists. George D. Watson (Dendodge).TalkHelp 19:55, 17 March 2008 (UTC)

  • Ahh, I see. Well, there were no references either, and it sort of seemed to be a joke. But it was non-notable, for sure. Thanks for telling me. Steve Crossin (talk) 20:08, 17 March 2008 (UTC)

MedCab Case

When the time comes yes, but this isnt going to be the normal format for a MedCab case in the beginning. Seddon69 (talk) 01:35, 18 March 2008 (UTC)

  • kk thanx mate :) keep an eye on the case. and ill make it clear when im ready for wider imput. Seddon69 (talk) 01:39, 18 March 2008 (UTC)

MedCab for Spore (video game)

You being mediator is fine. :) Nanobri (talk) 02:53, 18 March 2008 (UTC)

Re:Vandalism

Ok, thanks. THE KC (talk) 03:13, 18 March 2008 (UTC).

Regarding identifying the parties

I'm going to try to meet this request based on my best understanding of the degree to which people were involved, but others may disagree with me, so you might also ask User:Michael Safyan the same question. I would say that based on the volume of contributions over the last three months that the primary parties include him, me, User:Jaakobou, User:Timeshifter, User:Delad, User:Sm8900, and User:Gatoclass. Secondary parties are largely those who recently participated some heavily, some not, in the recent RfC, such as User:Nishidani, User:CasualObserver'48, User:Nickhh, User:Yahel Guhan, User:Ynhockey and User:IronDuke. I hope that helps some. Tiamuttalk 03:29, 18 March 2008 (UTC)

I is not Happy!

This place sucks! There's nothing but censorship everywhere! What's a matter? Can't handle the truth? This place makes me sick, I'm leaving! —Preceding unsigned comment added by 74.12.68.207 (talk) 03:58, 18 March 2008 (UTC)

  • Okay then. Censorship? The removal of this I do not consider censorship, I consider it cleaning up vandalsim. And Wikipedia is not censored. Steve Crossin (talk) 04:32, 18 March 2008 (UTC)

Mediator

You seem a very reasonable choice. Yes, you have my acceptance. Skele (talk) 06:42, 18 March 2008 (UTC)

Where do I make opening comments at? Nanobri (talk) 23:39, 22 March 2008 (UTC)

Assistance on article

Steve, can you please have a look at the new article Lucky Ashley. There is one editor. The article is badly written and I tagged it twice but the editor deleted boths tags. I issued a General note first time round but this time I'm wondering how to procede. Have a look at the article and see what you think. Maybe another editor tagging the article might make them change it. Have a look and see for yourself. Olly150 12:01, 18 March 2008 (UTC)

  • Sure, I've re-tagged the article with a CSD A7 template. If they remove it, I'll just follow the standard processes. Steve Crossin (talk) 12:04, 18 March 2008 (UTC)
Thanks Olly150 12:08, 18 March 2008 (UTC)

Thiruvalluvar

The ideas contained in the Traditional Accounts are totally Original Research and pushes a very racial propaganda that exists in Tamil Nadu. There is absolutely no citation to verify the malicious accusations of Aryan destruction of harmonious Dravidian society (much less the existence of distinct racial entities). Please revert your change and place it as it was, or leave a tag on the Topic that alerts readers of the Lack of Neutrality, the Original Research, and Controversial Opinions.

- Suraj

Thank you for the OR notification - but shouldn't blantantly malicious/racist OR be removed to maintain the integrity of the site?

I'm too lazy; but thank you for the OR notification - at the very least it'll give a heads up to people working on the Thiruvalluvar article to clean things up. It's really rudimentary considering the wealth of information online regarding the Sage.

216.252.71.146 (talk) 13:35, 18 March 2008 (UTC)Suraj

Haplogroup I1a (Y-DNA)

Can we call time out here and take it to the talk page? What is the objection to User:Aaronjhill's material ? Jheald (talk) 12:23, 18 March 2008 (UTC)

  • Hmm, I was merely on vandalism patrol, however it seems I may have made a mistake here.   Note that an admin did block them, however I feel I may be in error here. I had no personal objections to their material. Was my mistake. Steve Crossin (talk) 12:28, 18 March 2008 (UTC)
  • This was mentioned at WP:ANI, though it looks like you've already had a look. The thread may be found here. Thanks for your quick response, UltraExactZZ Claims ~ Evidence 12:55, 18 March 2008 (UTC)
  • I was going to leave you a snarky message about making sure edits really are vandalism before you report them as such, however your responses on User talk:Aaronjhill and WP:AN/I have really impressed me! Kudos to you, sir, for your willingness to admit you made a mistake (something that is entirely all too rare on the internet), and especially for your sincere apology! --Kralizec! (talk) 13:26, 18 March 2008 (UTC)
  • Just got your message on my talk page. You really are a class act! Keep up the good work! --Kralizec! (talk) 13:29, 18 March 2008 (UTC)
  • We seemed to have come accross the same line (380)":Forward 5′→ 3′: gcaacaatgagggtttttttg" - It looked like vandalism, came up on both Lupin and Huggle - but unforunately , it wasn't, and I have made a stupid error. Oh well - apologies to all those involved espec. Aaronjhill Olly150 13:32, 18 March 2008 (UTC)